Bio PrimarySeq
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::PrimarySeq - Bioperl lightweight Sequence Object
Package variables
Privates (from "my" definitions)
%valid_type = map {$_, 1} qw( dna rna protein )
Inherit
Bio::DescribableI Bio::IdentifiableI Bio::PrimarySeqI Bio::Root::Root
Synopsis
  # Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; # make from memory $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG', -id => 'GeneFragment-12', -accession_number => 'X78121', -alphabet => 'dna', -is_circular => 1 ); print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, "\n"; # read from file $inputstream = Bio::SeqIO->new(-file => "myseq.fa", -format => 'Fasta'); $seqobj = $inputstream->next_seq(); print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n"; # to get out parts of the sequence. print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, " and desc ", $seqobj->desc, "\n"; $string = $seqobj->seq(); $string2 = $seqobj->subseq(1,40);
Description
PrimarySeq is a lightweight Sequence object, storing the sequence, its
name, a computer-useful unique name, and other fundamental attributes.
It does not contain sequence features or other information. To have a
sequence with sequence features you should use the Seq object which uses
this object.
Although new users will use Bio::PrimarySeq a lot, in general you will
be using it from the Bio::Seq object. For more information on Bio::Seq
see Bio::Seq. For interest you might like to know that
Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls
to do with sequence to it (the has-a relationship lets us get out of a
otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this
object is a pure Perl implementation of the interface. If that's
gibberish to you, don't worry. The take home message is that this
object is the bioperl default sequence object, but other people can
use their own objects as sequences if they so wish. If you are
interested in wrapping your own objects as compliant Bioperl sequence
objects, then you should read the Bio::PrimarySeqI documentation
The documentation of this object is a merge of the Bio::PrimarySeq and
Bio::PrimarySeqI documentation. This allows all the methods which you can
call on sequence objects here.
Methods
newDescriptionCode
direct_seq_set
No description
Code
seqDescriptionCode
validate_seqDescriptionCode
subseqDescriptionCode
lengthDescriptionCode
display_idDescriptionCode
accession_numberDescriptionCode
primary_idDescriptionCode
alphabetDescriptionCode
descDescriptionCode
can_call_newDescriptionCode
idDescriptionCode
is_circularDescriptionCode
object_idDescriptionCode
versionDescriptionCode
authorityDescriptionCode
namespaceDescriptionCode
display_nameDescriptionCode
descriptionDescriptionCode
_guess_alphabetDescriptionCode
accession
No description
Code
Methods description
newcode    nextTop
 Title   : new
Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Function: Returns a new primary seq object from basic constructors, being a string for the sequence and strings for id and accession_number. Note that you can provide an empty sequence string. However, in this case you MUST specify the type of sequence you wish to initialize by the parameter -alphabet. See alphabet() for possible values. Returns : a new Bio::PrimarySeq object Args : -seq => sequence string -display_id => display id of the sequence (locus name) -accession_number => accession number -primary_id => primary id (Genbank id) -version => version number -namespace => the namespace for the accession -authority => the authority for the namespace -description => description text -desc => alias for description -alphabet => sequence type (alphabet) (dna|rna|protein) -id => alias for display id -is_circular => boolean field for whether or not sequence is circular -direct => boolean field for directly setting sequence (requires alphabet also set) -ref_to_seq => boolean field indicating the sequence is a reference (?!?) -nowarnonempty => boolean field for whether or not to warn when sequence is empty
seqcodeprevnextTop
 Title   : seq
Usage : $string = $obj->seq()
Function: Returns the sequence as a string of letters. The
case of the letters is left up to the implementer.
Suggested cases are upper case for proteins and lower case for
DNA sequence (IUPAC standard), but you should not rely on this.
Returns : A scalar
Args : Optionally on set the new value (a string). An optional second
argument presets the alphabet (otherwise it will be guessed).
validate_seqcodeprevnextTop
 Title   : validate_seq
Usage : if(! $seq->validate_seq($seq_str) ) {
print "sequence $seq_str is not valid for an object of
alphabet ",$seq->alphabet, "\n";
}
Function: Validates a given sequence string. A validating sequence string
must be accepted by seq(). A string that does not validate will
lead to an exception if passed to seq().
The implementation provided here does not take alphabet() into account. Allowed are all letters (A-Z) and '-','.','*','?','=', and '~'. Example : Returns : 1 if the supplied sequence string is valid for the object, and 0 otherwise. Args : The sequence string to be validated.
subseqcodeprevnextTop
 Title   : subseq
Usage : $substring = $obj->subseq(10,40);
$substring = $obj->subseq(10,40,NOGAP)
$substring = $obj->subseq(-START=>10,-END=>40,-REPLACE_WITH=>'tga')
Function: returns the subseq from start to end, where the first sequence
character has coordinate 1 number is inclusive, ie 1-2 are the
first two characters of the sequence
Returns : a string
Args : integer for start position
integer for end position
OR
Bio::LocationI location for subseq (strand honored)
Specify -NOGAP=>1 to return subseq with gap characters removed
Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
with $new_subseq in the sequence object
lengthcodeprevnextTop
 Title   : length
Usage : $len = $seq->length();
Function: Get the length of the sequence in number of symbols (bases
or amino acids).
You can also set this attribute, even to a number that does not match the length of the sequence string. This is useful if you don''t want to set the sequence too, or if you want to free up memory by unsetting the sequence. In the latter case you could do e.g. $seq->length($seq->length); $seq->seq(undef); Note that if you set the sequence to a value other than undef at any time, the length attribute will be invalidated, and the length of the sequence string will be reported again. Also, we won''t let you lie about the length. Example : Returns : integer representing the length of the sequence. Args : Optionally, the value on set
display_idcodeprevnextTop
 Title   : display_id or display_name
Usage : $id_string = $obj->display_id();
Function: returns the display id, aka the common name of the Sequence object.
The semantics of this is that it is the most likely string to be used as an identifier of the sequence, and likely to have "human" readability. The id is equivalent to the ID field of the GenBank/EMBL databanks and the id field of the Swissprot/sptrembl database. In fasta format, the >(\S+) is presumed to be the id, though some people overload the id to embed other information. Bioperl does not use any embedded information in the ID field, and people are encouraged to use other mechanisms (accession field for example, or extending the sequence object) to solve this. With the new Bio::DescribeableI interface, display_name aliases to this method. Returns : A string Args : None
accession_numbercodeprevnextTop
 Title   : accession_number or object_id
Usage : $unique_key = $obj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implemetation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should return "unknown". [Note this method name is likely to change in 1.3] With the new Bio::IdentifiableI interface, this is aliased to object_id Returns : A string Args : A string (optional) for setting
primary_idcodeprevnextTop
 Title   : primary_id
Usage : $unique_key = $obj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage their
own object ids in a way the implementaiton can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method should return a stringified memory location. Returns : A string Args : A string (optional, for setting)
alphabetcodeprevnextTop
 Title   : alphabet
Usage : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
Function: Get/Set the alphabet of sequence, one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called because this would cause upgrade problems from the 0.5 and earlier Seq objects. Returns : a string either 'dna','rna','protein'. NB - the object must make a call of the type - if there is no alphabet specified it has to guess. Args : optional string to set : 'dna' | 'rna' | 'protein'
desccodeprevnextTop
 Title   : desc or description
Usage : $obj->desc($newval)
Function: Get/set description of the sequence.
'description' is an alias for this for compliance with the Bio::DescribeableI interface. Example : Returns : value of desc (a string) Args : newvalue (a string or undef, optional)
can_call_newcodeprevnextTop
 Title   : can_call_new
Usage :
Function:
Example :
Returns : true
Args :
idcodeprevnextTop
 Title   : id
Usage : $id = $seq->id()
Function: This is mapped on display_id
Example :
Returns :
Args :
is_circularcodeprevnextTop
 Title   : is_circular
Usage : if( $obj->is_circular) { /Do Something/ }
Function: Returns true if the molecule is circular
Returns : Boolean value
Args : none
object_idcodeprevnextTop
 Title   : object_id
Usage : $string = $obj->object_id()
Function: A string which represents the stable primary identifier
in this namespace of this object. For DNA sequences this
is its accession_number, similarly for protein sequences.
This is aliased to accession_number(). Returns : A scalar
versioncodeprevnextTop
 Title   : version
Usage : $version = $obj->version()
Function: A number which differentiates between versions of
the same object. Higher numbers are considered to be
later and more relevant, but a single object described
the same identifier should represent the same concept.
Returns : A number
authoritycodeprevnextTop
 Title   : authority
Usage : $authority = $obj->authority()
Function: A string which represents the organisation which
granted the namespace, written as the DNS name for
organisation (eg, wormbase.org).
Returns : A scalar
namespacecodeprevnextTop
 Title   : namespace
Usage : $string = $obj->namespace()
Function: A string representing the name space this identifier
is valid in, often the database name or the name
describing the collection.
Returns : A scalar
display_namecodeprevnextTop
 Title   : display_name
Usage : $string = $obj->display_name()
Function: A string which is what should be displayed to the user.
The string should have no spaces (ideally, though a cautious
user of this interface would not assumme this) and should be
less than thirty characters (though again, double checking
this is a good idea).
This is aliased to display_id(). Returns : A scalar
descriptioncodeprevnextTop
 Title   : description
Usage : $string = $obj->description()
Function: A text string suitable for displaying to the user a
description. This string is likely to have spaces, but
should not have any newlines or formatting - just plain
text. The string should not be greater than 255 characters
and clients can feel justified at truncating strings at 255
characters for the purposes of display.
This is aliased to desc(). Returns : A scalar
_guess_alphabetcodeprevnextTop
 Title   : _guess_alphabet
Usage :
Function: Automatically guess and set the type of sequence: dna, rna or protein
Example :
Returns : one of strings 'dna', 'rna' or 'protein'.
Args : none
Methods code
newdescriptionprevnextTop
sub new {
    my ($class, @args) = @_;
    my $self = $class->SUPER::new(@args);

    my($seq,$id,$acc,$pid,$ns,$auth,$v,$oid,
       $desc,$description,
       $alphabet,$given_id,$is_circular,$direct,$ref_to_seq,$len,$nowarnonempty) =
      $self->_rearrange([qw(SEQ
                            DISPLAY_ID
                            ACCESSION_NUMBER
                            PRIMARY_ID
                            NAMESPACE
                            AUTHORITY
                            VERSION
                            OBJECT_ID
                            DESC
                            DESCRIPTION
                            ALPHABET
                            ID
                            IS_CIRCULAR
                            DIRECT
                            REF_TO_SEQ
                            LENGTH
                            NOWARNONEMPTY
                            )],
                            @args);
  
    # private var _nowarnonempty, need to be set before calling _guess_alphabet
$self->{'_nowarnonempty'} = $nowarnonempty; if( defined $id && defined $given_id ) { if( $id ne $given_id ) { $self->throw("Provided both id and display_id constructor ". "functions. [$id] [$given_id]"); } } if( defined $given_id ) { $id = $given_id; } # let's set the length before the seq -- if there is one, this length is
# going to be invalidated
defined $len && $self->length($len); # if alphabet is provided we set it first, so that it won't be guessed
# when the sequence is set
$alphabet && $self->alphabet($alphabet); # bernd's idea: define ids so that invalid sequence messages
# can be more informative...
defined $id && $self->display_id($id); $acc && $self->accession_number($acc); defined $pid && $self->primary_id($pid); # if there is an alphabet, and direct is passed in, assume the alphabet
# and sequence is ok
if( $direct && $ref_to_seq) { $self->{'seq'} = $$ref_to_seq; if( ! $alphabet ) { $self->_guess_alphabet(); } # else it has been set already above
} else { # print STDERR "DEBUG: setting sequence to [$seq]\n";
# note: the sequence string may be empty
$self->seq($seq) if defined($seq); } $desc && $self->desc($desc); $description && $self->description($description); $is_circular && $self->is_circular($is_circular); $ns && $self->namespace($ns); $auth && $self->authority($auth); defined($v) && $self->version($v); defined($oid) && $self->object_id($oid); return $self;
}
direct_seq_setdescriptionprevnextTop
sub direct_seq_set {
    my $obj = shift;
    return $obj->{'seq'} = shift if @_;
    return;
}
seqdescriptionprevnextTop
sub seq {
   my ($obj,@args) = @_;

   if( scalar(@args) == 0 ) {
       return $obj->{'seq'};
   }

   my ($value,$alphabet) = @args;

   if(@args) {
       if(defined($value) && (! $obj->validate_seq($value))) {
           $obj->throw("Attempting to set the sequence '".(defined($obj->id) ||
               "[unidentified sequence]")."' to [$value] which does not look healthy");
       }
       # if a sequence was already set we make sure that we re-adjust the
# alphabet, otherwise we skip guessing if alphabet is already set
# note: if the new seq is empty or undef, we don't consider that a
# change (we wouldn't have anything to guess on anyway)
my $is_changed_seq = exists($obj->{'seq'}) && (CORE::length($value || '') > 0); $obj->{'seq'} = $value; # new alphabet overridden by arguments?
if($alphabet) { # yes, set it no matter what
$obj->alphabet($alphabet); } elsif ($is_changed_seq || (! defined($obj->alphabet()))) { # if we changed a previous sequence to a new one or if there is no
# alphabet yet at all, we need to guess the (possibly new) alphabet
$obj->_guess_alphabet(); } # else (seq not changed and alphabet was defined) do nothing
# if the seq is changed, make sure we unset a possibly set length
$obj->length(undef) if $is_changed_seq || $obj->{'seq'}; } return $obj->{'seq'};
}
validate_seqdescriptionprevnextTop
sub validate_seq {
    my ($self,$seqstr) = @_;
    if( ! defined $seqstr ){ $seqstr = $self->seq(); }
    return 0 unless( defined $seqstr);
    if((CORE::length($seqstr) > 0) &&
        ($seqstr !~ /^([$MATCHPATTERN]+)$/)) {
            $self->warn("sequence '".(defined($self->id) || "[unidentified sequence]").
            "' doesn't validate, mismatch is " .
            join(",",($seqstr =~ /([^$MATCHPATTERN]+)/g)));
        return 0;
    }
    return 1;
}
subseqdescriptionprevnextTop
sub subseq {
   my $self = shift;
   my @args = @_;
   my ($start,$end,$nogap,$replace) = $self->_rearrange([qw(START 
                                                            END
                                                            NOGAP
                                                            REPLACE_WITH)],@args);
   
   # if $replace is specified, have the constructor validate it as seq
my $dummy = new Bio::PrimarySeq(-seq=>$replace, -alphabet=>$self->alphabet) if defined($replace); if( ref($start) && $start->isa('Bio::LocationI') ) { my $loc = $start; my $seq = ""; foreach my $subloc ($loc->each_Location()) { my $piece = $self->subseq(-START=>$subloc->start(), '-END'=>$subloc->end(), -REPLACE_WITH=>$replace, -NOGAP=>$nogap); $piece =~ s/[$GAP_SYMBOLS]//g if $nogap; if($subloc->strand() < 0) { $piece = Bio::PrimarySeq->new('-seq' => $piece)->revcom()->seq(); } $seq .= $piece; } return $seq; } elsif( defined $start && defined $end ) { if( $start > $end ){ $self->throw("Bad start,end parameters. Start [$start] has to be ". "less than end [$end]"); } if( $start <= 0 ) { $self->throw("Bad start parameter ($start). Start must be positive."); } # remove one from start, and then length is end-start
$start--; my @ss_args = map { eval "defined $_" ? $_ : () } qw( $self->{seq} $start $end-$start $replace); my $seqstr = eval join( '', "substr(", join(',',@ss_args), ")"); if( $end > $self->length) { if ($self->is_circular) { my $start = 0; my $end = $end - $self->length; my @ss_args = map { eval "defined $_" ? $_ : () } qw( $self->{seq} $start $end-$start $replace); my $appendstr = eval join( '', "substr(", join(',',@ss_args), ")"); $seqstr .= $appendstr; } else { $self->throw("Bad end parameter ($end). End must be less than the total length of sequence (total=".$self->length.")") } } $seqstr =~ s/[$GAP_SYMBOLS]//g if ($nogap); return $seqstr; } else { $self->warn("Incorrect parameters to subseq - must be two integers or a Bio::LocationI object. Got:", $self,$start,$end,$replace,$nogap); return; }
}
lengthdescriptionprevnextTop
sub length {
    my $self = shift;
    my $len = CORE::length($self->seq() || '');

    if(@_) {
        my $val = shift;
        if(defined($val) && $len && ($len != $val)) {
            $self->throw("You're trying to lie about the length: ".
                "is $len but you say ".$val);
        }
        $self->{'_seq_length'} = $val;
    } elsif(defined($self->{'_seq_length'})) {
        return $self->{'_seq_length'};
    }
    return $len;
}
display_iddescriptionprevnextTop
sub display_id {
   my ($obj,$value) = @_;
   if( defined $value) {
      $obj->{'display_id'} = $value;
    }
    return $obj->{'display_id'};
}
accession_numberdescriptionprevnextTop
sub accession_number {
    my( $obj, $acc ) = @_;

    if (defined $acc) {
        $obj->{'accession_number'} = $acc;
    } else {
        $acc = $obj->{'accession_number'};
        $acc = 'unknown' unless defined $acc;
    }
    return $acc;
}
primary_iddescriptionprevnextTop
sub primary_id {
    my $obj = shift;

    if(@_) {
        $obj->{'primary_id'} = shift;
    }
    if( ! defined($obj->{'primary_id'}) ) {
        return "$obj";
    }
    return $obj->{'primary_id'};
}
alphabetdescriptionprevnextTop
sub alphabet {
    my ($obj,$value) = @_;
    if (defined $value) {
        $value = lc $value;
        unless ( $valid_type{$value} ) {
        $obj->throw("Alphabet '$value' is not a valid alphabet (".
            join(',', map "'$_'", sort keys %valid_type) .") lowercase");
        }
        $obj->{'alphabet'} = $value;
    }
    return $obj->{'alphabet'};
}
descdescriptionprevnextTop
sub desc {
    my $self = shift;

    return $self->{'desc'} = shift if @_;
    return $self->{'desc'};
}
can_call_newdescriptionprevnextTop
sub can_call_new {
   my ($self) = @_;

   return 1;
}
iddescriptionprevnextTop
sub id {
   return shift->display_id(@_);
}
is_circulardescriptionprevnextTop
sub is_circular {
    my $self = shift;

    return $self->{'is_circular'} = shift if @_;
    return $self->{'is_circular'};
}
object_iddescriptionprevnextTop
sub object_id {
    return shift->accession_number(@_);
}
versiondescriptionprevnextTop
sub version {
    my ($self,$value) = @_;
    if( defined $value) {
        $self->{'_version'} = $value;
    }
    return $self->{'_version'};
}
authoritydescriptionprevnextTop
sub authority {
    my ($obj,$value) = @_;
    if( defined $value) {
        $obj->{'authority'} = $value;
    }
    return $obj->{'authority'};
}
namespacedescriptionprevnextTop
sub namespace {
    my ($self,$value) = @_;
    if( defined $value) {
        $self->{'namespace'} = $value;
    }
    return $self->{'namespace'} || "";
}
display_namedescriptionprevnextTop
sub display_name {
    return shift->display_id(@_);
}
descriptiondescriptionprevnextTop
sub description {
    return shift->desc(@_);
}
_guess_alphabetdescriptionprevnextTop
sub _guess_alphabet {
    my ($self) = @_;
    my $type;

    # Remove char's that clearly don't denote nucleic or amino acids
my $str = $self->seq(); $str =~ s/[-.?]//gi; # Check for sequences without valid letters
my $total = CORE::length($str); if( $total == 0 ) { if (!$self->{'_nowarnonempty'}) { $self->warn("Got a sequence with no letters in it ". "cannot guess alphabet"); } return ''; } if ($str =~ m/[EFIJLOPQXZ]/i) {
# Start with a safe method to find proteins.
# Unambiguous IUPAC letters for proteins are: E,F,I,J,L,O,P,Q,X,Z
$type = 'protein';
} else { # Alphabet is unsure, could still be DNA, RNA or protein.
# DNA and RNA contain mostly A, T, U, G, C and N, but the other letters
# they use are also among the 15 valid letters that a protein sequence
# can contain at this stage. Make our best guess based on sequence
# composition. If it contains over 70% of ACGTUN, it is likely nucleic.
if( ($str =~ tr/ATUGCNatugcn//) / $total > 0.7 ) {
if (
$str =~ m/U/i ) {
$type = 'rna';
} else { $type = 'dna'; } } else { $type = 'protein'; } } $self->alphabet($type); return $type; } ############################################################################
# aliases due to name changes or to compensate for our lack of consistency #
############################################################################
}
accessiondescriptionprevnextTop
sub accession {
    my $self = shift;

    $self->warn(ref($self)."::accession is deprecated, ".
        "use accession_number() instead");
    return $self->accession_number(@_);
}

1;
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Ewan BirneyTop
Email birney@ebi.ac.uk
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
Methods for Bio::IdentifiableI complianceTop
Methods for Bio::DescribableI complianceTop
This comprises of display_name and description.
Methods Inherited from Bio::PrimarySeqITop
These methods are available on Bio::PrimarySeq, although they are
actually implemented on Bio::PrimarySeqI
revcomTop
 Title   : revcom
Usage : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom".
The id is the same id as the orginal sequence, and the accession number is also indentical. If someone wants to track that this sequence has be reversed, it needs to define its own extensions. To do an inplace edit of an object you can go: $seqobj = $seqobj->revcom(); This of course, causes Perl to handle the garbage collection of the old object, but it is roughly speaking as efficient as an inplace edit. Returns : A new (fresh) Bio::SeqI object Args : none
truncTop
 Title   : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Example : Returns : A fresh Bio::SeqI implementing object. Args :
Internal methodsTop
These are internal methods to PrimarySeq